TGFBR2 CRISPR/Cas9 Lentivirus (Integrating)

Product Code
AMS.78535
$930.00
Order Support
Shipping Information
Product Updates
  • Keep up to date with product offers, resources and news

  • Sign up

Transforming growth factor receptor beta 2 (TGFBR2) encodes the TGF-? receptor protein, which is a transmembrane protein that forms a heterodimeric complex with other receptor proteins and binds TGF-?. This receptor/ligand complex phosphorylates proteins which regulate cell proliferation, cell cycle arrest, wound healing, and immunosuppression. Mutations in TGFBR2 have been linked with Marfan syndrome and the development of various types of tumors.The TGFBR2 CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles ready to infect most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human TGFBR2(Figure 1 and Table 2).The DNA transduced by this lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Knockdown efficiency is dependent on cell type.

Figure 1: Schematic of the lenti-vector used to generate the TGFBR2 CRISPR/Cas9 Lentivirus.

Gene Target:sgRNA Sequence:
TGFBR2-1-FACAGTGATCACACTCCATGT
TGFBR2-2-FTATCATGTCGTTATTAACTG
TGFBR2-3-FGCAGAAGCTGAGTTCAACCT
TGFBR2-4-FAAAGCGACCTTTCCCCACCA
TGFBR2-5-FACCTACAGGAGTACCTGACG


Table 1: List of sgRNA Sequences in the TGFBR2 CRISPR/Cas9 Lentivirus.

More Information
SKU AMS.78535
Size 500 ul x 2
Application Transient knockdown of TGFBR2 in target cellsGeneration of a stable TGFBR2 knockout cell line following puromycin selection and limiting dilution
Storage Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the virus at -80C. Avoid repeated freeze-thaw cycles. Titers can drop significantly with each freeze-thaw cycle.
Shipping Temp -80C
Supplier Name BPS