CRBN CRISPR/Cas9 Lentivirus (Integrating)
Product Code
AMS.78517
Order Support
- Email: [email protected]
Order Support
- Email: [email protected]
Order Support
-
T: +1 (800) 987 0985 (toll free)
-
Email: [email protected]
Order Support
-
Email: [email protected]
Shipping Information
-
Delivery charges will be calculated during checkout
Product Updates
-
Keep up to date with product offers, resources and news
Cereblon (CRBN) forms an E3 ubiquitin ligase complex which is responsible for ubiquitinating proteins that regulate various developmental processes. CRBN also binds to Calcium Activated Potassium Channel subunit alpha-1 (KCNMA1) to regulate ion transport. Moreover, mutations in CRBN may play an underlying role in tumor cells acquiring resistance to immunotherapy.The CRBN CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudotyped lentiviral particles that are ready to transduce almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human CRBN.The DNA transduced by this lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type. 
Figure 1: Schematic of the lenti-vector used to generate the CRBN CRISPR/Cas9 Lentivirus.
| Gene Target: | sgRNA Sequence: |
| CRBN | ACCAATGTTCATATAAATGG |
| CRBN | CTGACTGTGTTCTTAGCTCA |
| CRBN | TTACATACTGTATGTGATGT |
| CRBN | TTCTAATTGAACTGCAGACA |
| CRBN | TCAAGAAACAGCTACGTGAA |
Table 1: List of sgRNA Sequences in the CRBN CRISPR/Cas9 Lentivirus.
| SKU | AMS.78517 |
|---|---|
| Size | 500 ul x 2 |
| Application | • Transient knockdown of CRBN in target cell pools• Generation of a stable CRBN knockout cell line following puromycin selection and limiting dilution cloning |
| Storage | Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the virus at -80C. Avoid repeated freeze-thaw cycles. Titers can drop significantly with each freeze-thaw cycle. |
| Shipping Temp | -80C |
| Supplier Name | BPS |